Looking for a Tutor Near You?

Post Learning Requirement »
x

Choose Country Code

x

Direction

x

Ask a Question

x

x
x
For better view click here
x
Hire a Tutor
DISCOVER

Gene Editing

Loading...

Published in: Botany
15,794 Views

The basics of Gene Editing technology, Its types and applications in Gene Therapy.

Shobana J / Bangalore

2 years of teaching experience

Qualification: B.Sc (Periyar university - 2017)

Teaches: Science, Bio Technology, Biology, Botany, Zoology, Bio Chemistry, Microbiology, French

Contact this Tutor
  1. VNVCOHS
  2. WY-car IS GENE/9EffOME EDITING? Functions(SCOPE): Permanent repair of the underlying disease- causing mutation. Specific beneficial change at the intended genomic site (e.g. ß-globin gene) without impacting remainder of genome.
  3. GENOME EDITING croons SEQVEffCE-SÆC1f1C Zinc finger nuclease TAL effector nuclease ffjrmrn________ CRISPR-associated nuclease ffVCßEASES Genome editing tools have two features: v/ Recognize specific DNA sequences (i.e. specific genes or non-coding elements) Targeted Genome Editing Systems Cut DNA ("nuclease"), then a scar is left behind
  4. What is CRJSQR-Cas9)? Virus DNA Acquisition cas locus Plasrnid DNA Leader 10 9 8 7 6 5 4 3 CRISPR array Key Plasrnid DFC A cleaved Protospacer • PAM Repeat Spacer Transcription start 2 fit-st 3 I nterference 2 Expression Pre-crRNA Cas proteins crRNA Virus DNJA cleaved VMechanism of adaptive immunity in bacteria and archaea Evolved to adapt and defend against foreign genetic material (e.g. phage) V Several different types of CRISPR pathways in bacteria and archaea Type Il: CRISPR-Cas9. Creates a double-strand break in targeted DNA CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats Cas proteins: CRISPR-Associated proteins
  5. ffow does CRJSßR-Cas9 edit genome? Genomic DNA crRNA 5' PAM 3' Target DNA 3' GTGAGTCAGTCTGTGCGTG TGG ACC 3' CCACTCACTCACACACGCAC Illi 5' GGUGAGUGAGUGUGUGCGUG single chimeric Guide RNA guide RNA Cas9 protein tracrRNA a Natural bacteria/ system (Type Il): crRNA + tracrRNA + Cas9 protein Two components: single chimeric guide RNA + Cas9 protein Design crRNA to target any sequence next to a PAM (NGG/NCC) in the genome. Cas9 creates a double strand break (DSB) in the genome . DSB occurs on both strands, 3 base pairs upstream of the PAM. DSB is repaired by either NHEJ or HR tracrRNA: trans-activating CRISPR RNA (tracrRNA) PAM: Protospacer Adjacent Motif
  6. CRJSQR/Cas9 system in Cf CF is an autosomal recessive disorder. CFTR mutation at position 508 in exon 11, secretions are thin. Cl affects lungs and intestine Forskolin activates CFTR, leading to fluid secretion into the lumen and swelling of organoids. CFTR mutant organoids CFTR mRNA genomic CFTR F508del CRISPR/Cas9 mediated repair targeting vector DR genomic CFTR CRISPRCas9 ds-break CFTR repaired organoids genomic CFTR 508-cotrected + Fotskolin + Forskolin Correction of the CfTRlocus by ffDRin cultured intestinal stem cells from Cf patients
  7. The vision: mimicking common protective genetic variation_for therapeutic benefit (PROS: Loss of (BCLIIA expression in red blood cells causing increased fetal hemoglobin Spares (BCLIIA expression in other blood cells Modification would be permanent Survival advantage of cells (would outcompete unmodified cells) Compared to gene addition, no semi-random insertion of material into the genome, and no need for lifelong expression of foreign sequences
  8. COWS Of EffOME EDITIN Genome modification at sites other than the intended target (Preparation ("conditioning") therapy for stem cell transplant (shared rise of both gene addition and genome editing; potentially much less toxic than for "allotransplant " from related or unrelated donor)
  9. ARPLICATIOffS IffDAY-TO-DAYL1fE a CRISPR ON THE FARM - genetically modified crops e.g. corn, rice, soya beans, etc. - genetically modified animals e.g. pig, cattle.. a ENGINEERED ECOSYSTEMS wipe out disease-carrying mosquitoes or ticks a EDITING OUT DISEASE - Gene-therapy - the first clinical trials could happen in the next one or two years. i; "It will be hard to detect whether something has been mutated conventionally or genetically engineered.'

Need a Tutor or Coaching Class?

Post an enquiry and get instant responses from qualified and experienced tutors.

Post Requirement

Related PPTs

Upload PPTs

If you have your own PowerPoint Presentations which you think can benefit others, please upload on LearnPick. For each approved PPT you will get 100 Credit Points and 100 Activity Score which will increase your profile visibility.

Upload Now
Home > PowerPoint Slides > Gene Editing