Looking for a Tutor Near You?

Post Learning Requirement » x
Ask a Question
x

Choose Country Code

x

Direction

x

Ask a Question

x

Hire a Tutor
Delhi

Prokaryotic Transcription

Home > PowerPoint Slides > Prokaryotic Transcription
Published in: Bio Chemistry | Biotechnology | Zoology
4,119 Views

  The ppt gives an overall idea about mechanisms of prokaryotic transcription, an indispensable step of central dogma and is a must learn for biotechnology/zoology/botany students.    

Mainak B / Kolkata

9 years of teaching experience

Qualification: M.Sc (Bangalore University - [BU], Bangalore - 2006)

Teaches: Bio Technology, Biology, Botany, Physiology, Zoology, Bio Chemistry, Bio-informatics, Food & Nutrition, Microbiology, MBBS Tuition

Contact this Tutor
  1. THE CENTRAL DOGMA OF MOLECULAR DNA RNA BIOLOGY DNA REPLICATION RNA TRANSCRIPTIO PROTEINS What is TRANSCRIPTION? Transcription involves synthesis of an RNA representing one strand of a DNA duplex. the RNA is identical in sequence with one strand of the DNA, which is called the coding strand It is complementary to the other strand, which provides the template strand for its synthesis. One strand of DNA is transcribed into RNA Coding strand Template strand TRANSCRIPTION RNA transcript TACCCCCTACCCTCAATCCATCTACCT 3' ATGCGCCATGCCAGTTACGTAGATGGA RNA sequence IS complementary to template strand identical to coding strand 5'UACGCGGUACGGUCAAUGCAUCUACCU eviltuwEexl mw.ergito.tetw 1
  2. Transcription is the first stage in gene expression It is the principal step at which it is controlled. Regulatory proteins determine whether a particular gene is available to be transcribed by RNA polymerase. The initial (and often the only) step in regulation is the decision on whether or not to transcribe a gene. Most regulatory events occur at the initiation of transcription, although subsequent stages in transcription (or other stages of gene expression) are sometimes regulated. RNA synthesis is catalyzed by the enzyme RNA polymerase. Sequences prior to the startpoint are described as upstream of it Sequences after the startpoint (within the transcribed sequence) are downstream of it. Sequences are conventionally written so that transcription proceeds from left (upstream) to right (downstream) in the usual 5' to 3' direction. > The immediate product of transcription is called the rimar transcript. It would consist of an RNA extending from the promoter to the terminator, possessing the original 5' and 3' ends. RNA synthesis occurs in the transcription bubble 5' Transcription occurs by base pairing in a bubble of unpaired DNA... *RNA synthesis takes place within a "transcription bubble," in which DNA is transiently separated into its single strands, and the template strand is used to direct (complementarity) synthesis of the RNA strand. 3 5' 3' DNA is melted Transcri RNA synthesis initiates in bubble RNA chain is extended lion bubble Coding strand Tamplata strand VFR—erg i to.com 2
  3. RNA polymerase creates the transcription bubble when it binds to a promoter. The process of base pairing and base addition in the bubble is catalyzed and scrutinized by the enzyme. As RNA polymerase moves along the DNA template, it unwinds the duplex at the front of the bubble (the unwinding point), and rewinds the DNA at the back (the rewinding point). The lenqth of the transcription bubble is 'VI 2-14 bp, but the length of the RNA-DNA hybrid region within it is shorter The RNA-DNA hybrid is short and transient. As the enzyme moves on, the DNA duplex reforms, and the RNA is displaced as a free polynucleotide chain. The transcription bubble moves along DNA RNA polymerase surrounds the bubble Enzyme movement Rewinding point RNA binding site ONA coding strand Unwinding point NA template strand Catalytic site :cvirt1Ætut 3
  4. The Transcription Reaction has three stages: •Initiation , Initiatio describes the stages of transcription up to synthesis of the first nucleotide bond in RNA. This includes binding of RNA polymerase to the promoter and melting a short region of DNA into single strands. Elongation , Termination The Transcription Reaction has three stages: Elongation During elonqation the enzyme moves along the DNA and extends the arowina RNA chain. As the enzyme moves, it unwinds the DNA helix to expose a new segment of the template in single-stranded condition. Nucleotides are covalently added to the 3' end of the growing RNA chain, forming an RNA-DNA hybrid in the unwound region. Behind the unwound region, the DNA template strand pairs with its original partner to reform the double helix. The RNA emerges as a free single strand. • Initiation Elongation , Termination 4
  5. The Transcription Reaction has three stages: Initiation Elongation Terminatio Termination involves recognition of the point at which no further bases should be added to the chain To terminate transcription, the formation of phosphodiester bonds must cease, and the transcription complex must come apart. When the last base is added to the RNA chain, the transcription bubble collapses as the RNA DNA hybrid is disrupted, the DNA reforms in duplex state, and the enzyme and RNA are both released. RNA polyrnerase catalyzes transcription "Ternplete recognition: binds to duplex DNA is unv•ound at prornoter L Initiation: Very short chains are synthesized and released E Jon gat ion: polyrnerase synthesizes RNA RNA polymerase and RNA are released 5
  6. The Transcription Reaction has three stages: Initiation •Initiation describes the stages of transcription up to synthesis of the first nucleotide bond in RNA. This includes binding of RNA polymerase to the promoter and melting a short region of DNA into single strands. • Elongation Termination There are several stages in initiation Ho loenzyn-re Equil ibriurrn consta nt An open complex describes the stage of initiation of transcription when RNA polymerase causes the two strands of DNA to separate to form the "transcription bubble". Tight binding of RNA polymerase to DNA describes the formation of an open complex (when the strands of DNA have separated). The ternary complex in initiation of transcription consists of RNA polymerase and DNA and a dinucleotide that represents the first two bases in the RNA product. DNA binding 106- 10 e M I DNA bina Rate constant tm el ting A. barti v e initiation Release of sigrna k? —10 sec b' nary cognplex Rate cans tant ki 10 sec cognplex P rornater clearance sec synthesis beg ins Abortive initiation describes a process in which RNA polymerase starts transcription but terminates before it has left the promoter. It then reinitiates. Several cycles may occur before the elongation stage begin 6
  7. RNA polyrmerase cha nges size at initiation Initiation contains sign-ra and covers 75-80 bp -sa -40 --30 -20 -10 +20 •nitial elongation cornp.lex forrns at 10 may IOse Sigrrza. loses "from —35 to -55 -so -40 -ao -20 -10 +10 -+20 +30 General elongation cornplex fog-rms at 1 5-20 bases and •covers 30—40 bp —40 —ao -20 I + I O +20 + 30 Transcription in Bacteria RNA polymerase 7
  8. Burgess and Travers: Experiment: RNA polymerase was subjected to ion-exchange chromatography on a negatively charged resin — phosphocellulose. Result - o subunit has separated from holoenzyme. This caused a change in enzymatic activity 1 2 3 RNA polymerase structure E. coli RNA polymerase subunits. [3 - 150 kD 160 kD 6-70 kD (I- 40 kD (2 copies) w- 10 kD (not essential for enzyme activity) Holoenzyme = B, B', o, (12 Core Enzyme lacks and lacks specificity 8
  9. Core U2ßß'O RNA Polymerase Holo U2ßß'OO Ion exchange chromatography Core + Holoenzyme egative charge resin/phosphocellulose RNA POI can recognize authentic RNA pol binding site son T4 DNA and start transcription there Retain basic polymerase function (could still transcribe highly nicked template very well—Nicks and gaps provide ideal initiation sites for RNA Pol—this kind of initiation is non-specific Copyright: The %Graw-HiIl Companies. Permission required for reproductjcn or displav . ox 000 1 2 3 9
  10. Experiment: Hybridization competition Step 1: a DNA segment containing 2 regions X and Y transcribed in vitro in presence of labeled nucleotides (*NTPs ; 3H or 32P). If only region X is transcribed only X RNA is produced. Step 2: 2 DNA strands are separated by Transcription of region X with labeled NTPs heating—hybridise with labeled RNA— A transcript of one DNA strand base pairs with the template strand Step 3: Hybrids treated with RNase (to remove unhybridized RNA) Step 4: Extent of formation of labeled hybrids is measured Denature DNA (a) Hybridization with no competitor Measure labeled hybrids Experiment performed in the laboratory Immobilize ssDNA on a support (nitrocellulose filter) Hybridize radioactive XRNA* Treatment with RNase Measure radioactivity bound to filter (a) Hybridization with no competitor Label in hybrid Measure labeled hybrids Amount Of labe.leø RNA added Label in hybrid Amount of labeled RNA added 10
  11. Label in hybrid Amount of labeled RNA added Labelled hybrid reaches a saturation. When all available X-sites on the DNA have hybridized to labeled X-RNA. Excess labled X-RNA* remains unhybridized and is degraded by RNase From the result of this experiment: We know labeled RNA hybridizes with the template We do not know if it originated from region X or region Y Experiment 2: Start with saturating amount of labeled RNA (Expt. 1) Add increasing amount of unlabeled competitor RNA of known identity Case 1: If competitor is X RNA it will compete out X RNA* until no labeled hybrids are found (Show graph) Case 2: If competitor is Y RNA no competition is seen. Conclusion: labeled RNA is of X type. Region X and not region Y was transcribed. 11
  12. x he McGraw Hill Companies, Inc. Permission required 'or reproductionor display. Denature DNA Transcription of region X with labeled NTPs ( * NTP) (a) Hybridization with no competitor Measure labeled hybrids Label in hybrid Amount Of labeled RNA added (b) Hybridization with competitor Unlabeled competitor X RNAs Measure labeled hybrids Y RNA competitor Label in hybrid X RNA competitor Amount of unlabeled com etitor RNA added Experiment 3: Experiment 2 was performed with T4 DNA template, RNA POI (holo/core) in vitro Observations: E.coli a) Transcripts made by holoenzyme can be competed by T4 immediate early RNA. Holoenzyme is highly specific for immediate early genes. b) Product of core polymerase can be competed to about same extent by immediate early, delayed early and late T4 RNA. Core enzyme has no specificity. c) Core enzyme transcribes both DNA strands. 12
  13. Copyright @ The McGraw-Hill Companies, lnc. Permisslon required tor reproduction ?? display. ? ? ?? 75 50 25 ?? 75 50 25 250 (a) Core (b) Holoenzyme 750 1000 500 Competitor ???? added 3"J12, E.K.E. ?.?, ?????. .?.,?, 'E. ? ?4 ?"" 223:'023. 13

Need a Tutor or Coaching Class?

Post an enquiry and get instant responses from qualified and experienced tutors.

Post Requirement

Related PPTs

Upload PPTs

If you have your own PowerPoint Presentations which you think can benefit others, please upload on LearnPick. For each approved PPT you will get 50 Credit Points and 50 Activity Score which will increase your profile visibility.

Upload Now